ID: 1160510677_1160510686

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1160510677 1160510686
Species Human (GRCh38) Human (GRCh38)
Location 18:79451836-79451858 18:79451871-79451893
Sequence CCATCTGCGGCCTGGGCTTCGGC CGGTTCCCAGTCGGTGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 177} {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!