ID: 1160510677_1160510689

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1160510677 1160510689
Species Human (GRCh38) Human (GRCh38)
Location 18:79451836-79451858 18:79451887-79451909
Sequence CCATCTGCGGCCTGGGCTTCGGC GAGCAGGACCCACCTGTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 177} {0: 1, 1: 0, 2: 1, 3: 27, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!