ID: 1160528055_1160528058

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1160528055 1160528058
Species Human (GRCh38) Human (GRCh38)
Location 18:79548732-79548754 18:79548751-79548773
Sequence CCCGTCTCCGCGCACAGCTCACA CACAGCCCCGCATCCACCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!