ID: 1160537646_1160537667

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1160537646 1160537667
Species Human (GRCh38) Human (GRCh38)
Location 18:79603655-79603677 18:79603706-79603728
Sequence CCACCTTCCTGCAGTGCCGCCCT GTTCTTGCTGGCGGGGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!