ID: 1160550887_1160550898

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160550887 1160550898
Species Human (GRCh38) Human (GRCh38)
Location 18:79693162-79693184 18:79693202-79693224
Sequence CCCTGAGGCCTGTGAAGCCTGGC GTGGTGACCGGGAGGGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 85, 4: 841}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!