ID: 1160562370_1160562381

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1160562370 1160562381
Species Human (GRCh38) Human (GRCh38)
Location 18:79766695-79766717 18:79766737-79766759
Sequence CCTTCGTCTCTAGGTCAAGAGGG TCCTCTTCCGGCTTAGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!