ID: 1160570700_1160570714

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160570700 1160570714
Species Human (GRCh38) Human (GRCh38)
Location 18:79815820-79815842 18:79815860-79815882
Sequence CCCGCTGGCCTGTGTGCCCCGAT AGCTGAGCTGCACTGCCACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 111, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!