ID: 1160592516_1160592533

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1160592516 1160592533
Species Human (GRCh38) Human (GRCh38)
Location 18:79952098-79952120 18:79952145-79952167
Sequence CCCCGCGGGTCTCCGCTCCGATG CGGGGCCGTCGCCGGGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!