ID: 1160605101_1160605116

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1160605101 1160605116
Species Human (GRCh38) Human (GRCh38)
Location 18:80044376-80044398 18:80044428-80044450
Sequence CCCGAGTAGCCTGCATGATCCCC ACATTCACAGGCCTGTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 101} {0: 1, 1: 0, 2: 2, 3: 28, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!