ID: 1160605473_1160605489

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1160605473 1160605489
Species Human (GRCh38) Human (GRCh38)
Location 18:80046557-80046579 18:80046593-80046615
Sequence CCCAACCCCCTGGAGCTGGGCTC GCTGGGCTGGCACGTGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 225} {0: 1, 1: 0, 2: 3, 3: 21, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!