ID: 1160613912_1160613927

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1160613912 1160613927
Species Human (GRCh38) Human (GRCh38)
Location 18:80109583-80109605 18:80109618-80109640
Sequence CCACACCCACGCCCGCCGCCTGC CGTGGCCGCCTCGGGAATCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 678} {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!