ID: 1160668433_1160668451

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1160668433 1160668451
Species Human (GRCh38) Human (GRCh38)
Location 19:344508-344530 19:344552-344574
Sequence CCCCCGCCCGCCCCGCGCCGCCG GATGTGGCAGCCGGGGGAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!