ID: 1160668437_1160668461

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1160668437 1160668461
Species Human (GRCh38) Human (GRCh38)
Location 19:344514-344536 19:344566-344588
Sequence CCCGCCCCGCGCCGCCGCGCATG GGGAGTTGGGGGGTGGGGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 76, 3: 735, 4: 5157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!