ID: 1160668440_1160668447

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1160668440 1160668447
Species Human (GRCh38) Human (GRCh38)
Location 19:344519-344541 19:344545-344567
Sequence CCCGCGCCGCCGCGCATGCGCAC AGCCCGCGATGTGGCAGCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!