ID: 1160679838_1160679843

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1160679838 1160679843
Species Human (GRCh38) Human (GRCh38)
Location 19:407614-407636 19:407641-407663
Sequence CCTTGGCCTGGCTGTCCTGGGCG CTTTGAGCAGAGACACGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 378} {0: 1, 1: 0, 2: 1, 3: 20, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!