ID: 1160680060_1160680076

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1160680060 1160680076
Species Human (GRCh38) Human (GRCh38)
Location 19:408381-408403 19:408429-408451
Sequence CCCGGACAGGGGCTGCAGCGTCT AGTGGGGGGCGGCTGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 265} {0: 1, 1: 0, 2: 1, 3: 32, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!