ID: 1160680093_1160680120

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1160680093 1160680120
Species Human (GRCh38) Human (GRCh38)
Location 19:408480-408502 19:408533-408555
Sequence CCCGGCAGGGCCCTGCCGGCGGG CCGCCCAGGCGCGGCGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 340} {0: 1, 1: 0, 2: 2, 3: 32, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!