ID: 1160683265_1160683279

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1160683265 1160683279
Species Human (GRCh38) Human (GRCh38)
Location 19:422277-422299 19:422324-422346
Sequence CCGCCCGGCGGCTCATCCGGCCG TGTTCCTCCGTGGGGGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} {0: 1, 1: 0, 2: 0, 3: 46, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!