ID: 1160683272_1160683286

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1160683272 1160683286
Species Human (GRCh38) Human (GRCh38)
Location 19:422297-422319 19:422335-422357
Sequence CCGTGGTACCAGGGCTCCTGACG GGGGGCCACAGGGGCCCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 92} {0: 1, 1: 0, 2: 5, 3: 46, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!