ID: 1160686342_1160686349

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1160686342 1160686349
Species Human (GRCh38) Human (GRCh38)
Location 19:438668-438690 19:438685-438707
Sequence CCTGGCCCCTCTGGGGGTCTGGG TCTGGGGACGCCAGGCGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 450} {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!