ID: 1160691817_1160691823

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1160691817 1160691823
Species Human (GRCh38) Human (GRCh38)
Location 19:463815-463837 19:463839-463861
Sequence CCGTTCACTGTGTGGGAAACAGG CTGGCCTAGCAGCAGCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184} {0: 1, 1: 0, 2: 1, 3: 22, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!