ID: 1160697444_1160697449

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1160697444 1160697449
Species Human (GRCh38) Human (GRCh38)
Location 19:491810-491832 19:491827-491849
Sequence CCTGGGCGGAGACAGCCCCAGGC CCAGGCACCGCCTCTCCCCTGGG
Strand - +
Off-target summary No data {0: 4, 1: 3, 2: 9, 3: 35, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!