ID: 1160699999_1160700017

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1160699999 1160700017
Species Human (GRCh38) Human (GRCh38)
Location 19:501665-501687 19:501718-501740
Sequence CCAGTCCTGCACAGCCCGACCTC GTCTCCCGACACCACCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 197} {0: 2, 1: 2, 2: 3, 3: 16, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!