ID: 1160719141_1160719157

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1160719141 1160719157
Species Human (GRCh38) Human (GRCh38)
Location 19:589939-589961 19:589984-590006
Sequence CCTCGCCATGGACGCGCGCGGGG CCCGGGCGCGACCCCCGCGCCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 7, 4: 63} {0: 1, 1: 0, 2: 6, 3: 24, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!