ID: 1160729133_1160729144

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1160729133 1160729144
Species Human (GRCh38) Human (GRCh38)
Location 19:632801-632823 19:632849-632871
Sequence CCTCTCCCGGGCCGCCGTGGGGG CGTGGCCCCAGTCCTTCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 182} {0: 2, 1: 0, 2: 3, 3: 18, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!