ID: 1160767510_1160767515

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1160767510 1160767515
Species Human (GRCh38) Human (GRCh38)
Location 19:815018-815040 19:815035-815057
Sequence CCCGTGGCCAGCTGGATCACGTC CACGTCCGTCACCAGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 91} {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!