ID: 1160768101_1160768107

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1160768101 1160768107
Species Human (GRCh38) Human (GRCh38)
Location 19:817562-817584 19:817596-817618
Sequence CCTTGCTCAGGCATGGCCCCAGT CCTTGTTATGGCATCTTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!