ID: 1160769055_1160769064

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1160769055 1160769064
Species Human (GRCh38) Human (GRCh38)
Location 19:822141-822163 19:822170-822192
Sequence CCGGGGGTCTCGGGGGTCTCAGG CGAGCGGCTGGCGGGGCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 258} {0: 1, 1: 0, 2: 1, 3: 34, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!