ID: 1160775473_1160775487

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1160775473 1160775487
Species Human (GRCh38) Human (GRCh38)
Location 19:853231-853253 19:853258-853280
Sequence CCCCTGAGCCCCGCCTCTCCCTC GCAGAAACGTCCGCGCGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 164, 4: 1325} {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!