ID: 1160775477_1160775487

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1160775477 1160775487
Species Human (GRCh38) Human (GRCh38)
Location 19:853239-853261 19:853258-853280
Sequence CCCCGCCTCTCCCTCCCCGGCAG GCAGAAACGTCCGCGCGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 682} {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!