ID: 1160779716_1160779730

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1160779716 1160779730
Species Human (GRCh38) Human (GRCh38)
Location 19:872421-872443 19:872458-872480
Sequence CCCTCCTACAGCTGCGGGCCCGG TACTGGGAGCTGAGAGGACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 20, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!