ID: 1160782775_1160782784

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1160782775 1160782784
Species Human (GRCh38) Human (GRCh38)
Location 19:885176-885198 19:885208-885230
Sequence CCCAACATCCACTCACAGGAACG CCGGATGGTGCCCTCCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 142} {0: 1, 1: 0, 2: 0, 3: 18, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!