ID: 1160802400_1160802409

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1160802400 1160802409
Species Human (GRCh38) Human (GRCh38)
Location 19:976459-976481 19:976490-976512
Sequence CCATGTCTGGGGGCATTTGTGGT CTGGGGGGGCGCTCCTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 48, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!