ID: 1160816317_1160816327

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1160816317 1160816327
Species Human (GRCh38) Human (GRCh38)
Location 19:1037592-1037614 19:1037615-1037637
Sequence CCATGACCTGCTCCACCCCTCCT TCCTCTCCAGGTGGGCATGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 75, 4: 685} {0: 1, 1: 0, 2: 1, 3: 18, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!