ID: 1160817205_1160817213

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1160817205 1160817213
Species Human (GRCh38) Human (GRCh38)
Location 19:1041695-1041717 19:1041726-1041748
Sequence CCTTCACCAGGCCGCCAATACAT AGTGAGCTCTCCATCGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56} {0: 1, 1: 2, 2: 16, 3: 74, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!