ID: 1160818977_1160818990

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1160818977 1160818990
Species Human (GRCh38) Human (GRCh38)
Location 19:1049354-1049376 19:1049400-1049422
Sequence CCTGCGGGGGCTCAGCCTGGACT TTCCTGGGCCACAACGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 189} {0: 1, 1: 1, 2: 3, 3: 13, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!