ID: 1160821128_1160821133

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1160821128 1160821133
Species Human (GRCh38) Human (GRCh38)
Location 19:1058693-1058715 19:1058735-1058757
Sequence CCCTCTTCCTTCTCTTCACACTA AACTCCTGCCACAGTTAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 752} {0: 1, 1: 0, 2: 0, 3: 7, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!