ID: 1160853551_1160853568

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1160853551 1160853568
Species Human (GRCh38) Human (GRCh38)
Location 19:1206055-1206077 19:1206094-1206116
Sequence CCGCCGCCGCGCCGCCCCGCGGA CTCGGGGCGGGGCGCGCGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 483} {0: 1, 1: 1, 2: 1, 3: 45, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!