ID: 1160859388_1160859401

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160859388 1160859401
Species Human (GRCh38) Human (GRCh38)
Location 19:1231209-1231231 19:1231249-1231271
Sequence CCCTCCTCCTGCTCCGTGCTCTC GCTGGAAGTGGTGCCGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 872} {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!