ID: 1160865849_1160865866

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1160865849 1160865866
Species Human (GRCh38) Human (GRCh38)
Location 19:1255639-1255661 19:1255690-1255712
Sequence CCCCTCAGCCTCCCTGCTGCAGG CCCGGGTGAGTGGCCACCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 618} {0: 1, 1: 0, 2: 0, 3: 20, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!