ID: 1160871301_1160871306

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1160871301 1160871306
Species Human (GRCh38) Human (GRCh38)
Location 19:1279062-1279084 19:1279099-1279121
Sequence CCAGGACGCTGAGGCTCCCTTGC TGCCTCTCTCCTGCCCCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189} {0: 1, 1: 0, 2: 1, 3: 24, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!