ID: 1160873166_1160873174

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1160873166 1160873174
Species Human (GRCh38) Human (GRCh38)
Location 19:1286076-1286098 19:1286092-1286114
Sequence CCGCCCGCTCGGCGGCGGCGGCG GGCGGCGGCGGCGGAGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 79, 4: 428} {0: 21, 1: 104, 2: 1404, 3: 2580, 4: 8441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!