ID: 1160890591_1160890597

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1160890591 1160890597
Species Human (GRCh38) Human (GRCh38)
Location 19:1376622-1376644 19:1376635-1376657
Sequence CCTCCAGTGTGCATGAGCGTGTC TGAGCGTGTCTGAAGATGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80} {0: 1, 1: 1, 2: 0, 3: 8, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!