ID: 1160894747_1160894751

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1160894747 1160894751
Species Human (GRCh38) Human (GRCh38)
Location 19:1397160-1397182 19:1397182-1397204
Sequence CCCTCACAGAGAAGCTGGGAAAG GCTGCTGGTGACACACAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 345} {0: 1, 1: 1, 2: 1, 3: 35, 4: 721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!