ID: 1160895389_1160895410

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1160895389 1160895410
Species Human (GRCh38) Human (GRCh38)
Location 19:1399918-1399940 19:1399964-1399986
Sequence CCACCTCCAGGACCCGGCCCCCT TCACTAGGTGGGGCGGGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 59, 4: 622} {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!