ID: 1160896908_1160896913

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1160896908 1160896913
Species Human (GRCh38) Human (GRCh38)
Location 19:1407454-1407476 19:1407479-1407501
Sequence CCGACTGCGGCGGCGCGAAATCC CTCAGGGACGCACGCACAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 3} {0: 1, 1: 0, 2: 2, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!