ID: 1160917322_1160917327

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1160917322 1160917327
Species Human (GRCh38) Human (GRCh38)
Location 19:1503482-1503504 19:1503509-1503531
Sequence CCGACAGTAGCCTCATGAGCCAG GTCACGAGGAGGCCTGCGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!