ID: 1160918890_1160918903

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1160918890 1160918903
Species Human (GRCh38) Human (GRCh38)
Location 19:1510629-1510651 19:1510680-1510702
Sequence CCCCGCTCACCGGAGGCAGCGCC GGAGCTGGAGCAGCGGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137} {0: 1, 1: 0, 2: 3, 3: 66, 4: 553}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!