ID: 1160928810_1160928816

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1160928810 1160928816
Species Human (GRCh38) Human (GRCh38)
Location 19:1560111-1560133 19:1560133-1560155
Sequence CCTTGCTATGCCTGTTTCTTCAC CTGTGAAAGGGGAAGGTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 390} {0: 1, 1: 0, 2: 0, 3: 21, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!