ID: 1160947973_1160947984

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1160947973 1160947984
Species Human (GRCh38) Human (GRCh38)
Location 19:1652280-1652302 19:1652295-1652317
Sequence CCGCCCCCCGCCGGGCTCACCTG CTCACCTGCTGGGCGCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 467} {0: 1, 1: 0, 2: 2, 3: 15, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!